人类遗传病人类遗传病 (1).pdf

《人类遗传病人类遗传病 (1).pdf》由会员分享，可在线阅读，更多相关《人类遗传病人类遗传病 (1).pdf（6页珍藏版）》请在得力文库 - 分享文档赚钱的网站上搜索。

1、INTRODUCTIONThe early development of teeth as an epithelial appendage progressesthrough well-defined morphological changes,starting with the formationof the dental lamina as a thickened layer of dental epithelium and itssubsequent protrusion into underlying mesenchyme during bud,cap,andbell stages.D

2、uring the late-cap stage,multipotential precursor cellsdifferentiate along tooth-specific lineages and secrete components of theextracellular matrix required for formation of mineralized structures such asdentin,enamel,cementum,and bone.These morphological changes andcellular activities are controll

3、ed by sequential and reciprocal interactionsbetween dental epithelium and underlying mesenchyme(Kollar and Mina,1991).On a molecular level,the communication between these tissue layersis established by the secretion of morphogenetic factors and the activation ofresponsive transcription factors(Peter

4、s and Balling,1999).The mainmolecular signals during tooth formation include several multifunctionalgrowth factors of the Transforming Growth Factor(TGF)?,FibroblastGrowth Factor(FGF),Epidermal Growth Factor(EGF),Hedgehog(hh),and Wnt families(Jernvall and Thesleff,2000).These molecules bind totheir

5、respective receptors and trigger downstream responses through theactivation of transcription factors,leading to an altered gene expressionprofile in target cells.Several transcription factors of the homeobox,pairedbox,and high mobility group(HMG)box gene families are expressed atsites of tooth forma

6、tion and have been implicated in the determination oftooth shape and identity(McCollum and Sharpe,2001).Several of theseregulators act downstream of odontogenic signaling molecules,and theirfunctional importance in tooth development has been demonstrated by genedisruption in transgenic mice(Satokata

7、 and Maas,1994;van Genderen etal.,1994;Peters et al.,1998).In humans,mutations in the genes for thepaired-box-containing transcription factor PAX9 and the homeobox geneMSX1 have been linked to various tooth agenesis phenotypes(Frazier-Bowers et al.,2002).The largest class of transcription factors in

8、 the mammalian genome isthe C2H2zinc finger gene family,which is comprised of several hundredindividual members(Bellefroid et al.,1989;Tupler et al.,2001).Zinc fingergenes have been recognized as critical regulators of many fundamentalbiological processes(Matise and Joyner,1999),but little is known

9、about therole of zinc finger transcription factors in the regulation of gene expressionduring tooth development and the specification of individual tooth cellphenotypes.A random screening for genes expressed in apical dental pulpcells of rat incisors has previously identified the novel zinc finger g

10、enefragment Y150(Matsuki et al.,1995).The full-length Y150 was later namedKrox-26 due to the presence of five Krppel-like zinc finger repeats.Wehave shown that the murine Krox-26 orthologue is expressed predominantlyin developing craniofacial skeletogenic and dental structures,particularly insecreto

11、ry-stage ameloblasts(Ganss et al.,2002),providing further evidenceABSTRACTTooth development is mediated by sequential andreciprocal interactions between dental epitheliumand mesenchyme under the molecular control ofsecreted growth factors and responsivetranscription factors.We have previouslyidentif

12、ied the transcription factor Krox-26 as apotential regulator of tooth formation in mice.Thepurpose of this study was to investigate apotentially similar role for the human KROX-26orthologue.We cloned the KROX-26 gene andfound its single mRNA transcript(2.4 kb)to beexpressed in multiple adult tissues

13、.During fetaldevelopment,KROX-26 is expressed in theepithelial component of the developing toothorgan during early bud and cap stages as well as inosteoblasts of craniofacial bone and thedeveloping tongue.The KROX-26 gene wasmapped to chromosome 10q11.21,a locus that hasbeen associated with permanen

14、t tooth agenesis(He-Zhao deficiency).These results indicate apotential function for KROX-26 in the molecularregulation of tooth formation in humans.KEY WORDS:tooth development,zinc finger,He-Zhao deficiency,transcription factor.Received March 26,2003;Last revision June 23,2003;Accepted September 4,2

15、003The Human KROX-26/ZNF22Gene is Expressed at Sites of Tooth Formation and Maps to the Locus for Permanent ToothAgenesis(He-Zhao Deficiency)Y.Gao1,H.Kobayashi2,and B.Ganss1*1Canadian Institutes for Health Research(CIHR)Group inMatrix Dynamics,University of Toronto,Faculty ofDentistry,Fitzgerald Bui

16、lding,Room 239,150 CollegeStreet,Toronto,ON M5S 3E2,Canada;and 2TokyoMedical and Dental University,Department of Hard TissueEngineering(Periodontology),Bunkyo-ku,Tokyo,Japan;*corresponding author,b.ganssutoronto.caJ Dent Res82(12):1002-1007,2003RESEARCH REPORTSClinical1002 at The University of Iowa

17、Libraries on April 19,2015 For personal use only.No other uses without Downloaded from International and American Associations for Dental ResearchJ Dent Res 82(12)2003Cloning and Characterization of KROX-26/ZNF221003that Krox-26 may be involved in the molecular regulation oftooth development and ame

18、logenesis.The aim of the presentstudy was to identify and characterize the Krox-26 orthologuein humans,to analyze its expression with a particular emphasison developing dental tissues,and to determine its chromosomelocalization.MATERIALS&METHODSAll experiments were conducted under an approved human

19、ethicsprotocol for the collection of aborted human fetal tissues fromparticipants after their informed consent was obtained.Theprotocol was issued by the University of Toronto Health SciencesReview Committee in accordance with institutional and federalguidelines.Isolation of Human KROX-26The RPCI-11

20、 Bacterial Artificial Chromosome(BAC)Library(Osoegawa et al.,2001)was screened with a random primed,32P-dCTP-labeled 2-kb mouse Krox-26 cDNA fragment at the Centrefor Applied Genomics(Hospital for Sick Children,Toronto,ON).DNA from one positive clone(RP11-285G1)was isolated,digested with restriction

21、 endonucleases,and further analyzed bySouthern blot hybridization with the same 2-kb mouse Krox-26cDNA probe.Positive restriction fragments were agarose-gel-purified,treated with Klenow enzyme(Amersham-PharmaciaBiotech,Baie dUrf,QC,Canada),cloned into the SrfI site of pCRScript Amp SK(+)(Stratagene,

22、La Jolla,CA,USA),andsequenced(DNA Sequencing Facility,Centre for AppliedGenomics,Hospital for Sick Children,Toronto,ON,Canada).Northern Blot AnalysisA 674-bp PCR product was amplified from 30 ng of RP11-285G1BAC DNA as template with the primers HKROX-3?.1(AGCTCAAATCTCATTCAGCACCAG)and HKROX-5?.1(GCCT

23、GCACTTTCACAAATGTATCC)with the use ofAdvantage 2 DNA polymerase(BD Biosciences Clontech,PaloAlto,CA,USA)under the following conditions:one denaturationstep at 94C for 5 min,then 35 cycles of denaturation for 30 sec at94C,annealing for 30 sec at 62C,and extension at 72C for 40sec,followed by a final e

24、xtension step at 72C for 7 min.A 32P-dATP and 32P-dCTP double-labeled DNA antisense probe wasprepared from 100 ng of this PCR product with the primerHKROX-5?.1 and Klenow enzyme.A human 12-lane multiple-tissue Northern Blot(Clontech)was hybridized with this probe(3x 106cpm/mL)in ExpressHyb hybridiza

25、tion buffer(Clontech),according to the manufacturers instructions,and washed with 0.1 xSSC/0.1%SDS at 65C for 30 min.Signals were detected byautoradiography.The blot was stripped(0.5%SDS at 85C for 30min)and re-hybridized with a random-primed,32P-dCTP-labeledhuman?-actin probe(T7 QuickPrime kit,Amer

26、sham-PharmaciaBiotech,Piscataway,NJ,USA)for control of equal loadingbetween lanes and determination of relative expression levels.Were-hybridized the blot once with the Krox-26 probe to confirmreproducibility of results.In situ HybridizationPreparation of tissue sectionsTwelve-week-old human embryo

27、tissues were fixed with 4%paraformaldehyde(PFA)in phosphate-buffered saline(PBS)at4C overnight,washed in PBS,dehydrated in ethanol,andembedded in paraffin.For in situ hybridizations,sections of 8-?mthickness were cut,mounted on SuperFrost/Plus microscopy slides(Fisher Scientific,Nepean,ON,Canada),ai

28、r-dried at 45Covernight,and stored at 4C in a dry atmosphere.Probe synthesisThe 674-bp KROX-26 PCR fragment,described under NorthernBlot Analysis,was cloned into the pCR2.1-TOPO vector(Invitrogen,Burlington,ON,Canada)according to themanufacturers instructions,and the orientation of the insert wasdet

29、ermined by digestion with SacI.Plasmids containing cDNAfragments in either orientation were linearized with HindIII,anddigoxigenin-UTP-labeled antisense or sense RNA probes weresynthesized with T7 RNA polymerase and the DIG RNA LabelingKit(Roche Diagnostics,Laval,QC,Canada)according to themanufactur

30、ers instructions.Hybridization and signal detectionTissue sections were deparaffinized in xylene and rehydratedthrough ethanol(100%,95%,70%)and PBS.They were then re-fixed for 10 min in 4%PFA in PBS,washed for 2 15 min inDEPC-treated PBS,and incubated for 45 min in 10 mM SodiumCitrate(pH 6.0)at 80C.

31、After equilibration in 100 mMtriethanolamine at pH 8.0(TEA)for 2 min at room temperature(RT),the sections were acetylated for 2 x 5 min in 0.25%aceticanhydride in TEA with stirring,washed in 2 x SSC(0.3 M NaCl,0.03 M sodium citrate,pH 7.0)for 2 min,and dehydrated througha graded series of ethanol(70

32、%,95%,100%).Sections were pre-hybridized in hybridization mix(50%de-ionized formamide,300mM NaCl,10 mM Tris-HCl pH 7.6,5 mM EDTA,10 mMNaH2PO4,10%dextran sulphate,100 mg/mL yeast tRNA,1 xDenhardts solution)for 1 hr at 58C.The heat-denatured,digoxigenin-labeled cRNA probe was added at a concentration

33、of 1?g/mL and then hybridized overnight at 58C in a chambercontaining 50%Formamide/2xSSC as humidifying agent.Sectionswere then rinsed in 2 x SSC at RT,washed three times for 30 mineach at 65C in 50%formamide/2 x SSC,followed by one 30-minute wash at 65C in 50%formamide/1 x SSC.The remainingprobe wa

34、s detected immunologically with an anti-digoxi-genin/alkaline-phosphatase(AP)-conjugated antibody(Fabfragments,1:100 dilution)and Nitro blue tetrazolium chloride(NBT)and 5-Bromo-4-chloro-3-indolyl phosphate(BCIP)assubstrate,according to the manufacturers instructions(RocheDiagnostics).Fluorescence i

35、n situHybridization(FISH)Isolated BAC DNA from clone RP11-285G1 was biotinylated bynick translation and hybridized in situ to metaphase chromosomesprepared from normal human lymphocytes as described previously(Bray et al.,1991).Chromosomes were counterstained withpropidium iodide and 4?,6-diamidino-

36、2-phenylindol-dihydro-chloride(DAPI).After hybridization,the biotinylated probe wasdetected with avidin-fluorescein isothiocyanate(FITC).Images ofmetaphase chromosome preparations were captured digitally by acooled CCD camera(SenSys 1401E,Photometrics RoperScientific,Tucson,AZ,USA).RESULTSHuman KROX

37、-26 DNA and Protein SequenceOne positive clone,RP11-285G1,was obtained from the BAClibrary screening experiment,and a NarI/Bst1107I restrictionfragment(4.4 kb)was identified,cloned,and sequenced.This at The University of Iowa Libraries on April 19,2015 For personal use only.No other uses without Dow

38、nloaded from International and American Associations for Dental Research1004Gao et al.J Dent Res 82(12)2003fragment contains an intron-less open reading frame(ORF)of672 bp(Fig.1).A sequence comparison between this ORF andthe murine Krox-26 coding sequence(672 bp)revealed asequence identity of 81.5%a

39、t the nucleotide level.The lengthof the Krox-26 3?-UTR from translation stop codon topolyadenylation signal is similar between mouse(1429 bp)andhuman(1262 bp).The conceptually translated human proteincontains five consecutive C2H2(Kruppel-type)zinc fingerrepeats as the only recognizable functional d

40、omain,and has acalculated molecular weight of 25915.4Daltons and a predicted isoelectric point of10.06.A sequence comparison of humanand mouse Krox-26 proteins(Fig.2)revealed an overall sequence identity of85.3%,with the highest degree ofconservation(94.0%)within the zinc fingerdomain.The human KROX

41、-26 nucleotidesequence has been submitted to GenBankand was assigned the accession numberAY137767.Expression of KROX-26 in Fetal and Adult Human TissuesThe cellular expression of KROX-26mRNA was assessed by in situhybridization in 12-week-old embryonictissues(Fig.3A)and by Northernhybridization in a

42、dult tissues(Fig.3B).While hybridization with a digoxigenin-labeled cRNA sense probe did not produceany signals(Fig.3A:b,d,f,h,j,l),themost prominent signals with an antisensecRNA probe were found in specific areasof developing craniofacial structures intissues from 12-week-old embryos,including den

43、tal epithelium of maxillarymolar tooth organs at various stages ofdevelopment(Fig.3A,a,c,e;arrows),tongue epithelium(g),tongue muscle(i),and osteoblasts of craniofacial bone(k).Nosignal could be detected in any othertissues investigated at this developmentalstage,such as skeletal muscle,cartilage,or

44、long bones(not shown).The analysis of KROX-26 expression inadult tissues(Fig.3B)revealed theexistence of a single 2.4-kb mRNAtranscript,which is most highly expressed,relative to?-actin,in mesoderm-derivedtissues such as skeletal muscle,heart,kidney,and liver.Intermediate expressionlevels were obser

45、ved in spleen,thymus,and brain.Expression levels in endoderm-derived tissues such as intestine and colonwere found to be relatively low.Chromosomal Localization of KROX-26The genomic locus of the KROX-26 genewas determined by FITC fluorescence insitu hybridization(FISH)on metaphasechromosome spreads

46、(Fig.4).The singlehybridization signal on both alleles ofchromosome 10 was fine-mapped to the long arm of thechromosome at 10q11.21 by DAPI banding.DISCUSSIONWe have isolated the human orthologue of Krox-26,a zincfinger transcription factor that was previously identified as apotential regulator of e

47、arly tooth formation and amelogenesis(Matsuki et al.,1995;Lee et al.,1997;Ganss et al.,2002;Teoet al.,2003).The predicted human KROX-26 protein sequenceFigure 1.KROX-26 genomic DNA sequence.The NarI/Bst1107I genomic DNA fragment fromBAC clone RP11-285G1 contains the entire KROX-26 open reading frame

48、(underlined)as wellas 2.4 kb of upstream sequence and 1.3 kb of downstream sequence.Several TATA andCCAAT box consensus sites in the upstream region are shown in bold,and the conservedpolyadenylation site in the 3?-untranslated region is underlined.The sequence differencesbetween KROX-26 and the HKR

49、-T1 cDNA sequence are indicated in bold and italicized lowercase in positions 2517,2518,and 3074.at The University of Iowa Libraries on April 19,2015 For personal use only.No other uses without Downloaded from International and American Associations for Dental ResearchJ Dent Res 82(12)2003Cloning an

50、d Characterization of KROX-26/ZNF221005is coded by an intron-less openreading frame and,like its murinehomologue,contains fiveconsecutive Krppel-type C2H2zincfinger domains.A database searchviathe National Center forBiotechnology Information(NCBI)Basic Linear Alignment Search Tool(BLAST)program reve